View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_114 (Length: 296)
Name: NF11385A_low_114
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_114 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 119 - 290
Target Start/End: Original strand, 40877231 - 40877401
Alignment:
| Q |
119 |
gcttcttaataaatgttcttaggacactgattaacttgacctccttctaataaaagtaatgnnnnnnnn--ggtaccgtataattttttatttgaaataa |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
40877231 |
gcttcttaataaatgttcttaggacaccgattaacttgacct---tttaataaaagtaatgttttttttttggtacggtataattttttatttgaaataa |
40877327 |
T |
|
| Q |
217 |
aacgattatagtaagtggtgggactatcatttttcttcgtgatctttctattgatatcgatcattagagcatag |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40877328 |
aacgattatagtaagtggtgggactatcatttttcttcgtgatctttctattgatatcgatcattagagcatag |
40877401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 40877120 - 40877172
Alignment:
| Q |
8 |
tgatatgaagtcctaaatagaaactttattttagaaataatgcatctaaaatc |
60 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40877120 |
tgataagaagtcctaaatagaaactttattttagaaataatgcatctaaaatc |
40877172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University