View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_134 (Length: 279)
Name: NF11385A_low_134
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_134 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 97 - 148
Target Start/End: Complemental strand, 38823130 - 38823079
Alignment:
| Q |
97 |
agtattttatttccaaaatagctgaaaacattaattttgaggttgttttgtc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38823130 |
agtattttatttccaaaatagctgaaaacattaattttgaggttgttttgtc |
38823079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 166 - 206
Target Start/End: Complemental strand, 38823060 - 38823020
Alignment:
| Q |
166 |
tttgaggctgtggtgtgtgtgtatatatacatggttttcat |
206 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38823060 |
tttgaggttgtggtgtgtgtgtatatatacatggttttcat |
38823020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University