View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_157 (Length: 265)
Name: NF11385A_low_157
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_157 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 7 - 265
Target Start/End: Complemental strand, 2727939 - 2727679
Alignment:
| Q |
7 |
tttggtgtttatcctatggatacaaattggggagttgcattgcttgatcttttgggaaatttggcatttcctttgatattgcttggtactttactcctta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727939 |
tttggtgtttatcctatggatacaaattggggagttgcaatacttgatcttttgggaaatttggcatttcctttgatattgcttggtactttactcctta |
2727840 |
T |
|
| Q |
107 |
ggacatctagaaataattctgttggtggccctaacttgccatttggattaggaaggtatgaattgtagcacgtgaaacttcc--ataactataaggatct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
2727839 |
ggacatctagaaataattctgttggtggccctaacttgccatttggattaggaaggtatgaattgtagcacgtgaaacttccatataactataaggattt |
2727740 |
T |
|
| Q |
205 |
aattccgtatatgcatcgatagtgtaaagattttttatactgtcagtcgatcataattgtt |
265 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727739 |
aattccgtatatgcaccgacagtgtaaagattttttatactgtcagtcgatcataattgtt |
2727679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University