View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_158 (Length: 264)
Name: NF11385A_low_158
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_158 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 32255617 - 32255863
Alignment:
| Q |
1 |
tcaccctaaactgtcatgcctacatttgtgtgtcgtttctgctgttactaaattttacatccttacaagggggaaaaatacaacacagtgaagctacttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32255617 |
tcaccctaaactgtcatgcctacatttgtgtgtcatttctgctgttactaaattttacatccttacaagggggaaaaatacaacacagtgaagctacttg |
32255716 |
T |
|
| Q |
101 |
gactgcaaatgcaatgcatactaatttttattccacactataaactgtaggacaactgaaccgatatatgtaaatcaaaatacaaacatggaacgattag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
32255717 |
gactgcaaatgcaatgcatactaatttttatttaacactataaactgtaggacaactgaaccgatgtatgtaaatcaaaatacaaacatggaacgaatag |
32255816 |
T |
|
| Q |
201 |
ctaccagttcaaactaatggctaaatctagtagagcttctacttggc |
247 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32255817 |
ctaccagttcaaactaatagctaaatctagtagagcttctacttggc |
32255863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University