View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_175 (Length: 255)
Name: NF11385A_low_175
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_175 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 22 - 241
Target Start/End: Complemental strand, 38323361 - 38323142
Alignment:
| Q |
22 |
gtttttgaggttaagaagattcatggattgttgtttaaatttgggttggaattggatgtttttgttggaagtgctttggttactacttatttgaaatttt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38323361 |
gtttttgaggttaagaagattcatggattgttgtttaaatttgggttggaattggatgtttttgttggaagtgctttggttactacttatttgaaatttt |
38323262 |
T |
 |
| Q |
122 |
ggttggttgtggatgcacatgaggtgtttgaggaattgcctgttagagatgttgtgctttggaattcgatggttaatggatatgcgcagattgggtgctt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38323261 |
ggttggttgtggatgcacatgaggtgtttgaggaattgcctgttagagatgttgtgctttggaattcgatggttaatggatatgcacagattgggtgctt |
38323162 |
T |
 |
| Q |
222 |
tgaggaggctttggggatgt |
241 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38323161 |
tgaggaggctttggggatgt |
38323142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University