View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_178 (Length: 255)
Name: NF11385A_low_178
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_178 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 24 - 255
Target Start/End: Complemental strand, 45099455 - 45099224
Alignment:
| Q |
24 |
agattttgttatagattatggaacaaggttggttggtcctcctggtgtggaagagtatagaaatctttcatctcaggttttggaaactgttcataggatt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45099455 |
agattttgttatagattatggaacaaggttggttggtccttctggtgtggaagagtatagaaatctttcatctcaggttttggaaactgttcataggatt |
45099356 |
T |
|
| Q |
124 |
aatgtaggaggtatgaaaataactccttttaatgataccctttggagagcctggattcctgatgaggattatttggtttttaaggaagcagctaaacatg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45099355 |
aatgtaggaggtatgaaaataactccttttaatgacaccctttggagaacttggattcctgatgaggattatttggtttttaaggaagcagctaaacatg |
45099256 |
T |
|
| Q |
224 |
cagtaagcactcatacacctgattaccagaag |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45099255 |
cagtaagcactcatacacctgattaccagaag |
45099224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 100 - 254
Target Start/End: Original strand, 17348638 - 17348792
Alignment:
| Q |
100 |
gttttggaaactgttcataggattaatgtaggaggtatgaaaataactccttttaatgataccctttggagagcctggattcctgatgaggattatttgg |
199 |
Q |
| |
|
||||| |||||| |||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||| | |||||||||||| |||||| | ||| |
|
|
| T |
17348638 |
gttttagaaactattcataggattaatgttggaggtgaaaaattaactccttttaatgataccctttggagaacatggattcctgataaggattttctgg |
17348737 |
T |
|
| Q |
200 |
tttttaaggaagcagctaaacatgcagtaagcactcatacacctgattaccagaa |
254 |
Q |
| |
|
|||||||||| |||||||| || ||| |||||||| ||||| ||||| ||||| |
|
|
| T |
17348738 |
tttttaaggatgcagctaaggctgtagtgagcactcacacaccagattatcagaa |
17348792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 159
Target Start/End: Original strand, 17363885 - 17363945
Alignment:
| Q |
99 |
ggttttggaaactgttcataggattaatgtaggaggtatgaaaataactccttttaatgat |
159 |
Q |
| |
|
|||||| |||||| ||||||||||||| || | ||| ||||||||||||| ||||||||| |
|
|
| T |
17363885 |
ggttttagaaactattcataggattaacgttgatggtttgaaaataactccctttaatgat |
17363945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University