View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_199 (Length: 250)
Name: NF11385A_low_199
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_199 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 51376703 - 51376501
Alignment:
| Q |
17 |
gacatcaatgtggtcacaatgcgtatttgataattacaaatttaatgtttgatgctcaaaacttaaagattaatgtcaaatgcttgaaagttaaaaatat |
116 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51376703 |
gacatcaatgcggtcacaatgcgtatttgataattacaaatttaatgtttgatgctcgaaacttaaagattaatgtcaaatgcttgaaagttaaaaatat |
51376604 |
T |
 |
| Q |
117 |
gtaccttgcgtattttatcagtttgtctcatttacttgtgatgatgggtaactttgtaaggcgtttaagcctaatgcaatatgccctatatcatctctgg |
216 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51376603 |
gtaccttgcgtattttatgagtttgtctcatttacttgtgatgatgggtaactttgtaaggcgtttaagcctaatgcaatatgccctatatcatctctgg |
51376504 |
T |
 |
| Q |
217 |
aat |
219 |
Q |
| |
|
||| |
|
|
| T |
51376503 |
aat |
51376501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University