View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_222 (Length: 245)
Name: NF11385A_low_222
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_222 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 51 - 224
Target Start/End: Original strand, 28506738 - 28506911
Alignment:
| Q |
51 |
taaatatacaatagataaatcttgttcaacttaaaatgtgaatcttgaattttctaaaaaattactaacaattaaatagaaatggaaggagcacatcaaa |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28506738 |
taaatatacaatagataaatcttgttcaacttgaaatgtgaatcttgaattttctaaaaaattactaacaattaaatagaaatggaaggagcacatcaaa |
28506837 |
T |
|
| Q |
151 |
acgctactttggttcgcttatgagaaaatgaaattaaatggaatattgcacgaagttaacaataaggtatattt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28506838 |
acgctactttggttcgcttatgagaaaatgaaattaaatggaatattgcacgaagttaacaataaggtatattt |
28506911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 100
Target Start/End: Complemental strand, 28506674 - 28506642
Alignment:
| Q |
68 |
aatcttgttcaacttaaaatgtgaatcttgaat |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
28506674 |
aatcttgttcaacttgaaatgtgaatcttgaat |
28506642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University