View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_225 (Length: 245)
Name: NF11385A_low_225
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_225 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 1329668 - 1329429
Alignment:
| Q |
1 |
gctggttcctctggtggtggaagggccttgacttcattcatatcctcttccagttcatgtgcgggttcgggttccttggcttcttcatccgaattgttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329668 |
gctggttcctctggtggtggaagggccttgactgcattcatatcctcttccggttcaggttcgggttcgggttccttggcttcttcatccgaattgttct |
1329569 |
T |
 |
| Q |
101 |
cttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctctaacttctttggtgtgaccttatctatctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329568 |
cttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctctaacttctttggtgtgaccttatctatctc |
1329469 |
T |
 |
| Q |
201 |
agggtactcagaagagcgacaaattccaatattcttggac |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329468 |
agggtactcagaagagcgacaaattccaatattcttggac |
1329429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University