View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_235 (Length: 244)
Name: NF11385A_low_235
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_235 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 235
Target Start/End: Original strand, 24301046 - 24301264
Alignment:
| Q |
17 |
tcaatttagacatatcatattttatttccaaccctacaacctagtaaaatatctttaactttatgctcattcttgtaccaattttcatttgggcttcgaa |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
24301046 |
tcaacttagacatatcatattttatttccaaccatacaacctagtaaaatatctttaactttatgctcattcttgtaccaattttcacttgggctttgaa |
24301145 |
T |
 |
| Q |
117 |
gcccgcagtgtgggttcggatgagcatctgtttagagctattgatgagcttttttcaactcaacgaggaaacttttcttcaacattgatcagagtccact |
216 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||| |||| ||| ||||||||| | || |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24301146 |
gcccgcagtgtgggttatgatgcgcacctgtttggagccatttatgagctttcatacgcttaacggagaaacttttcttcaacattgatcagagtccact |
24301245 |
T |
 |
| Q |
217 |
ccaacacttccaacatatt |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24301246 |
ccaacacttccaacatatt |
24301264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University