View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_241 (Length: 243)
Name: NF11385A_low_241
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_241 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 15250238 - 15250448
Alignment:
| Q |
20 |
atgatttgcaacgtgttgtgttgtttgggggacctggtggattctgtggtctttgaaacatgtggttgtagatgatattggtcagaatgactttaattta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15250238 |
atgatttgcaacgtgttgtgttgtttggtggacctggtggattctgtggtctttaaaacatgtggttgtagatgatattggtcagaattactttaattta |
15250337 |
T |
 |
| Q |
120 |
ataaatgtatcatgggttctattttgtttcaaagtgatgatagttaata----ttatttactgttagcatgatgcactaaaaagttaaaacaacaccaaa |
215 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
15250338 |
ataaatgtgtcatgggttctattttgtttcaaag---tgatagttaatattatttatttactgttagcatgatgcactaaaaagttaaaacaacgctaaa |
15250434 |
T |
 |
| Q |
216 |
ctcgaaacacgaaa |
229 |
Q |
| |
|
||| || ||||||| |
|
|
| T |
15250435 |
ctcaaagcacgaaa |
15250448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University