View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_244 (Length: 242)
Name: NF11385A_low_244
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_244 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 29 - 221
Target Start/End: Original strand, 34344746 - 34344938
Alignment:
| Q |
29 |
aatatccaaggtggctccaaatttgtctttgaaggaggatgcaaaggtttgaatagaatcagcatctgagacatcaaggactagaaagtgaacatgatga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344746 |
aatatccaaggtggctccaaatttgtctttgaaggaggatgcaaaggttttaatagaatcagcatctgagacatcaaggactagaaagtgaacatgatga |
34344845 |
T |
 |
| Q |
129 |
tgaggtgcaacaaggcctaattgtgctcgaatcatctccacagcatcctctcctctcttcttgtctctagcagttaacactacactcagtccc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344846 |
tgaggtgcaacaaggcctaattgtgctcgaattctctccacagcatcctctcctttcttcttgtctctagcagttaacactacactcagtccc |
34344938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University