View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_248 (Length: 242)
Name: NF11385A_low_248
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_248 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 234
Target Start/End: Original strand, 19437954 - 19438167
Alignment:
| Q |
21 |
aagacctcaaatatcttcagtttttctgttaccaaaaagagtttcatgttcaactagttatggattgttgaagtctagaacacttcaacatgagtctata |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19437954 |
aagacctcaaatatcttcagtttttctgttaccaaaaagagtttcaagttcaactagttatggattgttgaagtctagaacacttcaacatgagtctata |
19438053 |
T |
|
| Q |
121 |
aattcaggcttggtgttctctccattggtgaagaaggcctttggagtaaatcaaagaaggtttcctgttgttgcagccttagcagcagatgctgatgata |
220 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
19438054 |
aattcaagcttggtgttctctccattggtgaagaaggcctttggagtaaatcaaagaaggtttccagttgttacagccttagcagcagatgctgatgata |
19438153 |
T |
|
| Q |
221 |
gtgaaattgaaatc |
234 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19438154 |
gtgaaattgaaatc |
19438167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University