View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_254 (Length: 239)
Name: NF11385A_low_254
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_254 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 67 - 239
Target Start/End: Original strand, 45594121 - 45594293
Alignment:
| Q |
67 |
tcaataattattcacactgaacaaaatcattcaaattaacatgctaggttttgttaacgaacctgaataggaaaaagttgagtaatcccacggtcacgta |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45594121 |
tcaataattattcacactgaacaaaatcattcaaattaacatgctaggttttgttaacgaacctgaataggaaaaagttgagtaatcccacggtcacgta |
45594220 |
T |
 |
| Q |
167 |
gcgaatcaacaagctgcgaaggcaaatcgagtttagaaatgtcaagttcatcagcgttaatagaagtagttcg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45594221 |
gcgaatcaacaagctgcgaaggcaaatcgagtttagaaatgtcaagttcatcagcgttaatagaagtagttcg |
45594293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University