View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_264 (Length: 235)
Name: NF11385A_low_264
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_264 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 23 - 216
Target Start/End: Complemental strand, 38145410 - 38145217
Alignment:
| Q |
23 |
cacttcttactcttagatggattccaagtttcttggagcaaattacggctgcttggacatgggaatcttgggagggtgtgaatatgaattcgggtttcgg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38145410 |
cacttcttactcttagatggattccaagtttcttggagcaaattacggctgcttggacatgggaatcttgggagggtgtgaatatgaattcgggtttcgg |
38145311 |
T |
 |
| Q |
123 |
tgtagatggtgccaaacaccttaggttcattgctaaggaatcaaggatggttgcgaatgaaggttcatttggagtgtaaattgttgtatgaaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38145310 |
tgtagatggtgccaaacaccttaggttcattgctaaggaatcaaggatggttgcgaatgaaggttcatttggagtgtaaattgttgtatgaaat |
38145217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 23 - 146
Target Start/End: Original strand, 11787410 - 11787533
Alignment:
| Q |
23 |
cacttcttactcttagatggattccaagtttcttggagcaaattacggctgcttggacatgggaatcttgggagggtgtgaatatgaattcgggtttcgg |
122 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| || ||| | || ||| |||||||||| ||||| ||||||||||||||||||||||||| || |
|
|
| T |
11787410 |
cacttcttactcttagatgaataccaagtttctttgaacaagtaacagctacttggacatgtgaatcggttaagggtgtgaatatgaattcgggttttgg |
11787509 |
T |
 |
| Q |
123 |
tgtagatggtgccaaacaccttag |
146 |
Q |
| |
|
| ||| ||| ||||| ||||||| |
|
|
| T |
11787510 |
agcagaaggtaccaaataccttag |
11787533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University