View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_265 (Length: 235)
Name: NF11385A_low_265
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_265 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 19190381 - 19190615
Alignment:
| Q |
1 |
gtggacgttttggtggtggttatggttccgatgaccgttctggtggtggttatggcgctaatgaccgttatgagagtggatatgggcgttctgggggtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19190381 |
gtggacgttttggtggtggttatggttccgatgaccgttctggtggtggttatggcgctaatgaccgttatgagagtggatatgggcgttctggtggtgg |
19190480 |
T |
|
| Q |
101 |
atatggtgatggagggcgtacgagtattggtggatatggcgaagaaaaccgttctagtggtggctatggatatggagggcgttctagtggttacggtaat |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190481 |
atatggtgatggagggcgttcgagtattggtggatatggcgaagaaaaccgttctagtggtggctatggatatggagggcgttctagtggttacggtaat |
19190580 |
T |
|
| Q |
201 |
gagcaaagttttggagggtatggtagggatggtcg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190581 |
gagcaaagttttggagggtatggtagggatggtcg |
19190615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University