View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_270 (Length: 233)
Name: NF11385A_low_270
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_270 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 115 - 218
Target Start/End: Original strand, 26417844 - 26417947
Alignment:
| Q |
115 |
cctaacgtgcatttttccttcaagcgaattgcattgaaccgagcttctaaattcttcttctgatgaataatggactcgaatgtatcatgcttcaagatcg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26417844 |
cctaacgtgcatttttccttcaagcgaattgcattgaaccgagcttctaaattcttcttctgatgaataatggactcgaatgtataatgcttcaagatcg |
26417943 |
T |
|
| Q |
215 |
tgat |
218 |
Q |
| |
|
|||| |
|
|
| T |
26417944 |
tgat |
26417947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 26417722 - 26417807
Alignment:
| Q |
4 |
gtgctttcagtgagattttgacaccgactcaaagaatgcaat-----------gtatcaagcccttaatgataattatcacttgtt |
78 |
Q |
| |
|
||||||| | |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
26417722 |
gtgcttttattgagattttgacactgactcaaagaatgcaatttacttttatcgtatcaagcccttaatgataattaccacttgtt |
26417807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University