View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_282 (Length: 230)
Name: NF11385A_low_282
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_282 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 5 - 225
Target Start/End: Original strand, 29802310 - 29802530
Alignment:
| Q |
5 |
actataatttctcttaatcttgggggagagttttgactcttgtccccctctactatattctttgctttctaatatatttgggtgacgccatgctaggctc |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29802310 |
actatcatttctcttaatcttgggggagagttttgactcttgtccccctctactatattctttgctttctaatatatttgggtgacgccatgctaggctc |
29802409 |
T |
|
| Q |
105 |
tcattgttttgatgatc-ggggtggacgattttaaaaagtgaagtgataagaagtggagggttcaatccacatctacgtattactagctttttctattta |
203 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29802410 |
tcattgttttgatgatcgggggtggagga-tttaaaaagtgaagtgataagaagtggagggttcaatccacatctacgtattactagctttttctattta |
29802508 |
T |
|
| Q |
204 |
gaaaaactggaggaccaaaagt |
225 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
29802509 |
gaaaaaccggaggaccaaaagt |
29802530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University