View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11385A_low_283 (Length: 230)

Name: NF11385A_low_283
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11385A_low_283
NF11385A_low_283
[»] chr6 (3 HSPs)
chr6 (3-62)||(24125247-24125306)
chr6 (178-225)||(24124424-24124471)
chr6 (87-133)||(24124500-24124546)
[»] chr8 (1 HSPs)
chr8 (3-62)||(45163377-45163435)


Alignment Details
Target: chr6 (Bit Score: 52; Significance: 6e-21; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 3 - 62
Target Start/End: Complemental strand, 24125306 - 24125247
Alignment:
3 gagtgttcacttttcttattttgaaagttttcaaatgttcttttcagttaggttgcttat 62  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||    
24125306 gagtgttcacttttcttattttgaaagtttccaaatgttcttttcagttagattgcttat 24125247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 178 - 225
Target Start/End: Complemental strand, 24124471 - 24124424
Alignment:
178 ttatcttcacagtttggtatgcaatttatgcatggctacggatggtgt 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
24124471 ttatcttcacagtttggtatgcaatttatgcatggctacggatggtgt 24124424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 87 - 133
Target Start/End: Complemental strand, 24124546 - 24124500
Alignment:
87 tttggcgactcttgtatcatatctcttctttgttttatatatataat 133  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||    
24124546 tttggcgactcttgtatcgtatctcttctttgttttatatatataat 24124500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 62
Target Start/End: Original strand, 45163377 - 45163435
Alignment:
3 gagtgttcacttttcttattttgaaagttttcaaatgttcttttcagttaggttgcttat 62  Q
    ||||||||||||| |||||||||||||||||||||| ||||||||| ||| | |||||||    
45163377 gagtgttcactttacttattttgaaagttttcaaat-ttcttttcaattacgctgcttat 45163435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University