View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11385A_low_291 (Length: 230)

Name: NF11385A_low_291
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11385A_low_291
NF11385A_low_291
[»] chr8 (1 HSPs)
chr8 (41-210)||(31798689-31798862)


Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 41 - 210
Target Start/End: Complemental strand, 31798862 - 31798689
Alignment:
41 aattgattttaattgctagttcgattgctcagtagaacaattcttgcaagattttgttt--atataattcaagtagnnnnnnnnnn--aataggaattca 136  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||  |||||||||||||||            ||||||||||||    
31798862 aattgattttaattactagttcgattgctcagtagaacaattcttgcaagattttttttttatataattcaagtagttttttttttttaataggaattca 31798763  T
137 agtaggcaatttgaagattcaagttcaatcacgaaacaatggatggtccatgaaaatcttatgacaaagccact 210  Q
    ||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
31798762 agtaggcaatttgtagattcaagttcaatcacgaaataatggatggtccatgaaaatcttatgacaaagccact 31798689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University