View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_306 (Length: 228)
Name: NF11385A_low_306
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_306 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 7 - 131
Target Start/End: Original strand, 45594489 - 45594613
Alignment:
| Q |
7 |
ggaggaggtgggaatggaagttagtttgtgtgttttgtagagttcgagagagggaagtttgcatgcggtggaagcaccgattgaggttatggaagccatt |
106 |
Q |
| |
|
|||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45594489 |
ggaggaagtgggaatggaagtgagtttgtgttttttgtagagttcgagagagggaagtttgcatgcggtggaagcaccgattgaggttatggaagccatt |
45594588 |
T |
|
| Q |
107 |
tttatggttcttcgttcttcttctg |
131 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45594589 |
tttatggttcttcgttcttcttctg |
45594613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University