View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_307 (Length: 228)
Name: NF11385A_low_307
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_307 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 5 - 194
Target Start/End: Complemental strand, 38949441 - 38949255
Alignment:
| Q |
5 |
gtgtggttggggaccggtgaaaggtacggaaagataaatgggggtgcatgagcatgagctgacatgtgtttgttgcatgaagaaaaagtaaaggagagat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38949441 |
gtgtggttggggaccggtgaaaggtacggaaagataaatgggggtgcatgagcatgagctgacatgtgtttgttgcatgaagaaaaagtaaaggagagat |
38949342 |
T |
|
| Q |
105 |
aatgataagatagatcagatcatatcatatcatcatagtctgcattattattaggacttactactatccaccgtatctttcaaaaccttc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38949341 |
aatgataagatagatcagatcatatcata---tcatagtctgcattattattagcacttactactatccaccgtatctttcaaaaccttc |
38949255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University