View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_314 (Length: 226)
Name: NF11385A_low_314
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_314 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 12844054 - 12843835
Alignment:
| Q |
7 |
tccgccaccttcaataccttcgccgcaaccgtaatctccgtaaccgtaatctcgttgtcggccttggcgttcaatggactcccggcaaccttgatcctcc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12844054 |
tccgccaccttcaataccttcgccgcaaccgtaatctctgtaaccgtaatctcattgtcggccttggcgttcaatggactcccggcaaccttgatcctcc |
12843955 |
T |
|
| Q |
107 |
cgccgacacgctacagttatgcatcagtggcagctgtcttatcttccacctctctcgcgcagatatgattccggtcagtctctgcaattttctccgtcat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12843954 |
cgccgacacgctacagttatgcatcagtggcagctgtcttatcttccacctctctctcgccgatatgattccggttagtctctgcaactttctccgtcat |
12843855 |
T |
|
| Q |
207 |
cctaagaacaccttcgttgg |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
12843854 |
cctaagaacaccttcgttgg |
12843835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 42 - 226
Target Start/End: Original strand, 12861462 - 12861646
Alignment:
| Q |
42 |
ctccgtaaccgtaatctcgttgtcggccttggcgttcaatggactcccggcaaccttgatcctcccgccgacacgctacagttatgcatcagtggcagct |
141 |
Q |
| |
|
||||| ||| ||||||| ||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12861462 |
ctccgcaactgtaatcttgttgtcggcctcggcgttcaatggactaaccgcaaccttgatcctcccgccgacacgctacagttatgcatcggtggcagct |
12861561 |
T |
|
| Q |
142 |
gtcttatcttccacctctctcgcgcagatatgattccggtcagtctctgcaattttctccgtcatcctaagaacaccttcgttgg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12861562 |
gtcttatcttccacctctctcgcgcagatatgattccggtcagtctctgcaattttctccgtcatcctaagaacaccttcgttgg |
12861646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University