View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_317 (Length: 226)
Name: NF11385A_low_317
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_317 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 21 - 163
Target Start/End: Complemental strand, 41429536 - 41429394
Alignment:
| Q |
21 |
ataactcgtctttacaggaaaactcaaacattctatcattaaaactgtcaatttgtaacaactcaatgcatttgggtgatcaccgacgggtcactatatt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41429536 |
ataactcgtctttacaggaaaactcaaacattctatcattaaaactgtcaatttgtaacaactcaatgcatttgggtgatcactgacgggtcactatatt |
41429437 |
T |
|
| Q |
121 |
atagatcaggttggatttgccaaattaattacgaaccagtttt |
163 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41429436 |
atagatcaggttggatttgcccaattaattacgaaccagtttt |
41429394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 147 - 207
Target Start/End: Complemental strand, 41429369 - 41429309
Alignment:
| Q |
147 |
aattacgaaccagttttccatcttattttcgttcttttgattttttgacatatgaattttc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41429369 |
aattacgaaccagttttccatcttattttcgttcttttgattttttgacatatgaattttc |
41429309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University