View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_321 (Length: 225)
Name: NF11385A_low_321
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_321 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 31 - 220
Target Start/End: Complemental strand, 14801843 - 14801654
Alignment:
| Q |
31 |
ttaagtaccaggcaaaataccgttatgatcaacaacaaaaattgaatcaaaaccaaagcagaacttgaataaaaattcaatccttatgagattaaatgag |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14801843 |
ttaagtaccaggcaaaataccgttatgatcaacaacaaaaattgaatcaaaaccaaagcagaacttgaataaaaattcaatccttatgagattaaatgag |
14801744 |
T |
|
| Q |
131 |
tcttatgtggctgtgtgatcacaattattgcaaatggagcttcttaaattgtttattattgtagatggaagcgttttcctaatatgaaca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14801743 |
tcttatgtggctgtgtgatcacaattattgcaaatggagcttcttaaattgtttattattgtaaatggaagcgttttcctaatatgaaca |
14801654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University