View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_326 (Length: 220)
Name: NF11385A_low_326
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_326 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 220
Target Start/End: Complemental strand, 35425978 - 35425759
Alignment:
| Q |
12 |
agaggagtaaaaacgtttctaatttcatcacagaataggaaggcaccaaaatttttatcaagttataactaacatgatcaaatacttgagtattcaaaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35425978 |
agaggagtaaaaacgtttctaatttcatcacagaataggaaggcaccaaaattttaatcaagttataactaacatgatcaaatacttgaatattcaaaaa |
35425879 |
T |
 |
| Q |
112 |
attgaaaagctttcggattcacatttgcttttggacaatcttgcaaggtgt-----------gatgttccacacacctagggcaagaaggatcactaact |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35425878 |
attcaaaagctttcggattcacatttgcttttggacaatcttgcaaggtgtgaagttccatggatgttccacacacctagggcaagaaggatcactaact |
35425779 |
T |
 |
| Q |
201 |
atgtgatgctgaatctcaag |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
35425778 |
atgtgatgctgaatctcaag |
35425759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University