View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_338 (Length: 217)
Name: NF11385A_low_338
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_338 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 16 - 145
Target Start/End: Complemental strand, 44870311 - 44870182
Alignment:
| Q |
16 |
atatcaaatgtccccccttctcacagatagcagaaattgtcaagcattttgcagccataaggacatacttccatataaacacatcaagtcctgtgtctac |
115 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44870311 |
atatcaaatgtcccccctcctcacagatagcagaaattgtcaagcattttgcagccataaggacatacttccatataaacacatccagtcctgtgtctac |
44870212 |
T |
|
| Q |
116 |
acggctcatggaaacataaagaatggcaca |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44870211 |
acggctcatggaaacataaagaatggcaca |
44870182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 143 - 217
Target Start/End: Complemental strand, 44870147 - 44870073
Alignment:
| Q |
143 |
acagaaacacctgttgattcaatttcatatccgttatcatacatagacattacaatgttccgtacctatcaggtt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44870147 |
acagaaacacctgttgattcaatttcatatccgttatcatacatagacattacaatgttccgtacctatcaggtt |
44870073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 50 - 138
Target Start/End: Complemental strand, 44859335 - 44859247
Alignment:
| Q |
50 |
aattgtcaagcattttgcagccataaggacatacttccatataaacacatcaagtcctgtgtctacacggctcatggaaacataaagaa |
138 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||| |||| |
|
|
| T |
44859335 |
aattgtcaagcattgtgcagccataaggacatatttccatataaacacatctagtcctgtgtctacacggctcatgctaacatacagaa |
44859247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University