View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11385A_low_341 (Length: 215)

Name: NF11385A_low_341
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11385A_low_341
NF11385A_low_341
[»] chr3 (1 HSPs)
chr3 (10-215)||(53675856-53676061)


Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 10 - 215
Target Start/End: Complemental strand, 53676061 - 53675856
Alignment:
10 aaatgaaggttgggcagacagaagaactcgggcgtccataagtctatcccttttggcagcagaagaagaccttagaattctattataatttcttcnnnnn 109  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||         
53676061 aaatgaaggttgggcagacagaagaactcgggcgtccataaatctatcccttttggcagcagaagaagaccttagaattctattataatttcttcaaaaa 53675962  T
110 nnnnnnngaattctattataattggttgacttttacatgcatatattgttgtggataatggtccactggtctgaggtttacagggctggtgtctttcctt 209  Q
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53675961 agaaaaagaattctattataattggttgacttttacatgcatatattgttgtggataatggtccactggtctgaggtttacagggctggtgtctttcctt 53675862  T
210 ataaaa 215  Q
    ||||||    
53675861 ataaaa 53675856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University