View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_342 (Length: 215)
Name: NF11385A_low_342
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_342 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 54428610 - 54428799
Alignment:
| Q |
20 |
cttatttgccatgtcatcatcatttgcaccacttttat-----------tccacactcataacaatatggtattaagttgtgtttagatattgtaatgat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54428610 |
cttatttgccatgtcatcatcatttgcaccacttttatcaattgggcattccacactcataacaatatggtattaagttgtgtttagatattgtaatgat |
54428709 |
T |
|
| Q |
109 |
tccctcnnnnnnngatattgtaatgatggatgtataaaaagttatttttgtactaagtaaactctttcaactctagagtgaagtctatga |
198 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54428710 |
tccctcaaaaaaagatattgtaatgatggatgtataagaagttatttttgtactaagtaaactctttcaactctagagtgaagtctatga |
54428799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University