View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_345 (Length: 211)
Name: NF11385A_low_345
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_345 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 9 - 211
Target Start/End: Complemental strand, 3429505 - 3429303
Alignment:
| Q |
9 |
aacatagaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccacaactattactccctccttatggcacactccaa |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3429505 |
aacaaagaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccgcaactattactccctccttatggcacactccaa |
3429406 |
T |
|
| Q |
109 |
tcccatatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaacca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429405 |
tcccatatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaacca |
3429306 |
T |
|
| Q |
209 |
aga |
211 |
Q |
| |
|
||| |
|
|
| T |
3429305 |
aga |
3429303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 14 - 211
Target Start/End: Complemental strand, 3426021 - 3425824
Alignment:
| Q |
14 |
agaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccacaactattactccctccttatggcacactccaatccca |
113 |
Q |
| |
|
||||||||||||||||| ||||||||||| | |||||||||||||||| |||| |||||| ||||||||| ||| ||||||||||||||||||||| ||| |
|
|
| T |
3426021 |
agaagacaaaatgaggagtatacccaccaaattgctaaacacacaccctaacatcaccccaacaactattcctcactccttatggcacactccaatgcca |
3425922 |
T |
|
| Q |
114 |
tatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaaga |
211 |
Q |
| |
|
|||||||||||||||||||| || ||||| || ||||||||||||||||| |||| |||||||||||| | ||||| |||||||||| |||||||||| |
|
|
| T |
3425921 |
tatctctttggaggactagctgctattataggtctcatagccttggcgttattggtactagcatgctcatattgtagactctcaagggacaaccaaga |
3425824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University