View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_356 (Length: 206)
Name: NF11385A_low_356
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_356 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 21 - 187
Target Start/End: Original strand, 34431523 - 34431689
Alignment:
| Q |
21 |
attataatgttatcgtgattctgtcaaattcaccattcggatgagatatatgatatgatacatacttttcattcaaccttccaagcatatagaaacaagc |
120 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34431523 |
attataatgttatcgtgattttgtcaaattcaccattcggatgagatatatgatatgatacatacttttcattcaaccttccaagcatatagaaacaagc |
34431622 |
T |
 |
| Q |
121 |
aatactctgatgaggatgataatgaatcactgacactacggccctccactgaatcacaagtactact |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34431623 |
aatactctgatgaggatgataatgaatcactgacactacggccctccactgaatcacaagtactact |
34431689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 86 - 133
Target Start/End: Original strand, 43402602 - 43402649
Alignment:
| Q |
86 |
ttttcattcaaccttccaagcatatagaaacaagcaatactctgatga |
133 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
43402602 |
ttttcattcaaccttccaagcataaagaaacaagcaaaactctgatga |
43402649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University