View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_67 (Length: 346)
Name: NF11385A_low_67
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 100 - 335
Target Start/End: Original strand, 29578242 - 29578477
Alignment:
| Q |
100 |
gaagattggaacatgcttgctgctgattgtgttgtcatatcttgctgctgccaatgcttggttctgcaaattcttgtgcttgtattgcgaaagatggtga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29578242 |
gaagattggaacatgcttgctgctgattgtgttgtcatatcatgctgctgccaatgcttggttctgcaaattcttgtgcttgtattgcgaaagatggtga |
29578341 |
T |
|
| Q |
200 |
gaaaaacaagagaatatggtaagaaaatattttgtcaaaggaaggggaattatagaggggtgcaaagagaaatgggatcttataaagatgtggttttgag |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29578342 |
gaaaaacaagagaatatggtaagaaaatattttgtcaaaggaaggggaattatagaggggtgcaaagagaaatggggtcttataaagatgtggttttgag |
29578441 |
T |
|
| Q |
300 |
aattcaagaagattacgcactaaaagatgatgatgt |
335 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29578442 |
aattcaagaagattatgcactaaaagatgatgatgt |
29578477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University