View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_85 (Length: 325)
Name: NF11385A_low_85
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_85 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 7 - 325
Target Start/End: Complemental strand, 38244002 - 38243684
Alignment:
| Q |
7 |
aaaccattactacgccaccgccgcagataccgcctttcgatcaccaacctcatccgtattatggaccatccgccgatgaagttttcgccaagcgtaaaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38244002 |
aaaccattactacgccaccgccgcagataccgccgttcgatcaccaacctcatccgtattatggaccatccgccgatgaagttttctccaagcgtaaaca |
38243903 |
T |
 |
| Q |
107 |
gttccttggtccttccttgttccatttctatcaaaaacccgtcagttcctatcatcaaactcatttctcttctttaatttcatttattgtttgttacnnn |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243902 |
gttccttggtccttccttgttccatttctatcaaaaacccgtcagttcctatcatcaaactcatttctcttctttaatttcatttattgtttgttacttt |
38243803 |
T |
 |
| Q |
207 |
nnnnnnatagaagaagaaattgatgatgaatgatgtttgtatagttgaatattgtggaggggaagatgcaatatctgtatgatgaagctggaagacgtta |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243802 |
ttttttatagaagaagaaattgatgatgaatgatgtttttatagttgaatattgtggaggggaagatgcaatatctgtatgatgaagctggaagacgtta |
38243703 |
T |
 |
| Q |
307 |
ccttgatgcttttgctggg |
325 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38243702 |
ccttgatgcttttgctggg |
38243684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University