View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_low_91 (Length: 316)
Name: NF11385A_low_91
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_low_91 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 9 - 196
Target Start/End: Complemental strand, 45684186 - 45683998
Alignment:
| Q |
9 |
tggtgttgctgtgaaactggtaatcccttgataaaattgtttaccaactcatcctttgatttaatgtattctataatatttatcagacataaatatccat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45684186 |
tggtgttgctgtgaaactggtaatcccttgataaaattgtttaccaactcatcctttgatctaatgtattctataatatttatcagacataaatatccat |
45684087 |
T |
|
| Q |
109 |
cgctttgtgc-ttttgatatttttgctctcacttttgaacctatttagtcttcgcacctgcannnnnnnnggttactatttatggaatc |
196 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
45684086 |
cgctttgtgctttttgatatttttgctctcacttttgaacctatttagtcttcgcgcctgcattttttttggttactatttatggaatc |
45683998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 217 - 316
Target Start/End: Complemental strand, 45683917 - 45683818
Alignment:
| Q |
217 |
cacttcgatgttgtttccatcgactttcatgtgctaattagaaacatttgttgtaatcttcttggcaggcggactctgaagtgcatatacattggaaagg |
316 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683917 |
cacttagatgttgtttccatcgactttcatgtgctaatcagaaacgtttgttgtaatcttcttggcaggcggactctgaagtgcatatacattggaaagg |
45683818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University