View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385_high_19 (Length: 280)
Name: NF11385_high_19
Description: NF11385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 53 - 241
Target Start/End: Complemental strand, 5132055 - 5131867
Alignment:
| Q |
53 |
gtgtccaagtcttttgatttaccttttttacatgcttgcccgtttgtattcaagcgttgttgacctgagtgcataaaccctaaccctgtcacttgctttc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5132055 |
gtgtccaagtcttttgatttaccttttttacatgcttgcccgtttgtattcaagcgttgttgtcctgagtgcataaaccctaaccctgtcacttgctttc |
5131956 |
T |
 |
| Q |
153 |
accaatcttcaacctttgctgtcactattcattcttctttctttatcaataatcagcattatgttaactgtaatgtttctttgctattt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5131955 |
accaatcttcaacctttgctgtcactattcattcttctttctttatcaataatcagcattatgttaactgtaatgtttctttgctattt |
5131867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 40
Target Start/End: Complemental strand, 5132098 - 5132069
Alignment:
| Q |
11 |
caaaggctaagtgtctaagtctttttccct |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5132098 |
caaaggctaagtgtctaagtctttttccct |
5132069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University