View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385_high_22 (Length: 252)
Name: NF11385_high_22
Description: NF11385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385_high_22 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 252
Target Start/End: Complemental strand, 36275727 - 36275491
Alignment:
| Q |
16 |
agacaagactgatgaagtagaacaaaacggtgaagaagaaacaaccggagcaggagaacccggatccgaattggaaacattatcttgctgttgaagaaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36275727 |
agacaagactgatgaagtagaacaaaacggtgaagaagaaacaaccggagcaggagaacccggatccgaattcgaaacattatcttgctgttgaagaaga |
36275628 |
T |
 |
| Q |
116 |
tgtcgttgttgttctttaggtcgtgattcgggtagttcagagttattatccaacccgaatagataatcgggtacttcagaaaccatagaagaagcttctg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36275627 |
tgtcgttgttgttctttaggtcgtgattcgggtagttcagagttattatccaaaccgaatagataatcgggtacttcagaaaccatagaagaagcttctg |
36275528 |
T |
 |
| Q |
216 |
atcttcctcgttctaaacccgaaacgccaccgtttaa |
252 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36275527 |
atcttcctcgttctaaaccagaaacgccaccgtttaa |
36275491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University