View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385_high_23 (Length: 248)
Name: NF11385_high_23
Description: NF11385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 45684182 - 45684323
Alignment:
| Q |
1 |
caccacctcgttttttctcagaattaaaggggaagacatggagaatctttgatcttgatctgacaagttcaaaattcattcccaactgccacgagaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45684182 |
caccacctcgttttttctcagaattaaaggggaagacatggagaatctttgatcttgatctgacaagttcaaaattcattcccaactgccacgagaattc |
45684281 |
T |
|
| Q |
101 |
aataatttgaacttcaaatcaatacgttaatcaaggaataga |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45684282 |
aataatttgaacttcaaatcaatacgttaatcaaggaataga |
45684323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 175 - 248
Target Start/End: Original strand, 45684356 - 45684429
Alignment:
| Q |
175 |
cagggagggtaccttcactgcccaagatagaattgccttctctgtaggagatcctgaaatctctgcttctccac |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45684356 |
cagggagggtaccttcactgcccaagatagaattgccttctctgtaggagatcctgaaatctctgtctctccac |
45684429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 180 - 238
Target Start/End: Complemental strand, 1442968 - 1442910
Alignment:
| Q |
180 |
agggtaccttcactgcccaagatagaattgccttctctgtaggagatcctgaaatctct |
238 |
Q |
| |
|
|||||||||| |||||||| || ||||||||||||||||| || |||||||||| |||| |
|
|
| T |
1442968 |
agggtaccttgactgcccatgaaagaattgccttctctgtcggtgatcctgaaacctct |
1442910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University