View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385_low_16 (Length: 332)
Name: NF11385_low_16
Description: NF11385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 9e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 192 - 319
Target Start/End: Complemental strand, 5789946 - 5789819
Alignment:
| Q |
192 |
aacaaccaagtctatatttttgttcatatttgtgtggctatagttggatttttcttggtaacattatcaactatggttatcaaactttgaacaagaaaca |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5789946 |
aacaaccaagtctatatttttgttcatatttgtgtggctatagttggatttttcttggtaacattatcaactatggttatcaaactatgaacaagaaaca |
5789847 |
T |
 |
| Q |
292 |
aatgtagattactacttcttattcatct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5789846 |
aatgtagattactacttcttattcatct |
5789819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 43 - 170
Target Start/End: Complemental strand, 5790105 - 5789975
Alignment:
| Q |
43 |
tgatattttctaatgttgtgaaagagaacagag--gaaaagacagaaagtgcaacgtcagagtttaacagtagggttcccctttggtttgtggttttgga |
140 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5790105 |
tgatattttctaatgttgtgaaaaagaacagagaggaaaagacagaaagtgcaacgtcagagtttaacagtagggttcccctttggtttgtggttttgga |
5790006 |
T |
 |
| Q |
141 |
caagttca-ggattccctcttctcatccaca |
170 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
5790005 |
caagttcagggattccctcttctcatccaca |
5789975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University