View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385_low_17 (Length: 303)
Name: NF11385_low_17
Description: NF11385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 296
Target Start/End: Original strand, 53675788 - 53676066
Alignment:
| Q |
18 |
ggaccaagtgcgtacatactagatttggttaaacaaaccaaaaggatctgacacatgaaactatatctttttataaggaaagacaccagccctgtaaacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675788 |
ggaccaagtgcgtacatactagatttggttaaacaaaccaaaaggatctgacacatgaaactatatctttttataaggaaagacaccagccctgtaaacc |
53675887 |
T |
|
| Q |
118 |
tcagaccagtggaccattatccacaacaatatatgcatgtaaaagtcaaccaattataatagaattcnnnnnnnnnnnngaagaaattataatagaattc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53675888 |
tcagaccagtggaccattatccacaacaatatatgcatgtaaaagtcaaccaattataatagaattctttttcttttttgaagaaattataatagaattc |
53675987 |
T |
|
| Q |
218 |
taaggtcttcttctgctgccaaaagggatagacttatggacgcccgagttcttctgtctgcccaaccttcattttctgt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675988 |
taaggtcttcttctgctgccaaaagggatagatttatggacgcccgagttcttctgtctgcccaaccttcattttctgt |
53676066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University