View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385_low_28 (Length: 237)
Name: NF11385_low_28
Description: NF11385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 106 - 223
Target Start/End: Complemental strand, 45683917 - 45683800
Alignment:
| Q |
106 |
cacttcgatgttgtttccatcgactttcatgtgctaattagaaacatttgttgtaatcttcttggcaggcggactctgaagtgcatatacattggaaagg |
205 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683917 |
cacttagatgttgtttccatcgactttcatgtgctaatcagaaacgtttgttgtaatcttcttggcaggcggactctgaagtgcatatacattggaaagg |
45683818 |
T |
 |
| Q |
206 |
tgctgctgagatagttct |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45683817 |
tgctgctgagatagttct |
45683800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 45684075 - 45683998
Alignment:
| Q |
8 |
ttttgatatttttgctctcacttttgaacctatttagtcttcgcacctgcannnnnnnnggttactatttatggaatc |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
45684075 |
ttttgatatttttgctctcacttttgaacctatttagtcttcgcgcctgcattttttttggttactatttatggaatc |
45683998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 223
Target Start/End: Original strand, 16691130 - 16691183
Alignment:
| Q |
170 |
gcaggcggactctgaagtgcatatacattggaaaggtgctgctgagatagttct |
223 |
Q |
| |
|
|||||| |||||||| || |||||||||||||||||||||||||| || ||||| |
|
|
| T |
16691130 |
gcaggctgactctgatgttcatatacattggaaaggtgctgctgaaattgttct |
16691183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 223
Target Start/End: Original strand, 1443415 - 1443470
Alignment:
| Q |
168 |
tggcaggcggactctgaagtgcatatacattggaaaggtgctgctgagatagttct |
223 |
Q |
| |
|
||||||| |||||||| |||||||||||| |||||||| ||||| || |||||||| |
|
|
| T |
1443415 |
tggcaggtggactctggagtgcatatacactggaaaggagctgcagaaatagttct |
1443470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University