View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_high_15 (Length: 316)
Name: NF11386A_high_15
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_high_15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 12 - 316
Target Start/End: Original strand, 39772068 - 39772381
Alignment:
| Q |
12 |
gaaagaacatcagaacacaatctcatacggtcgcctttatcacaattgatagatttgggaacattgggaatcgaaacacggccaggaagctcaacagtac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39772068 |
gaaagaacatcagaacacaatctcatacggtcgcctttatcacaattgatagatttgggaacattgggaatcgaaacacggccaggaagctcaacagtac |
39772167 |
T |
 |
| Q |
112 |
gaaggttgtcgtggtcaatagcaatcaatttagaatcatatttacagaatttgagtcttagatcgttggtgagatcgtaacctaatccaacggatttaat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39772168 |
gaaggttgtcgtggtcaatagcaatcaatttggaatcatatttgcagaatttgagtcttagatcgttggtgagatcgtaacctaatccaacggatttaat |
39772267 |
T |
 |
| Q |
212 |
cacatcttcaacagacaacaccttcttcttacttgaca---------tcttcttcttcaaaaatcgttcatcaactaagtaagaagtagtttatttatga |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39772268 |
cacatcttcaacagacaacaccttcttcttacttgacatcttcttcttcttcttcttcaaaaatcgttcatcaactaagtaagaagtagtttatttatga |
39772367 |
T |
 |
| Q |
303 |
aagcaaaaaccaaa |
316 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39772368 |
aagcaaaaaccaaa |
39772381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University