View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_104 (Length: 361)
Name: NF11386A_low_104
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_104 |
 | |
|
| [»] scaffold0007 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0007 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 197 - 361
Target Start/End: Complemental strand, 149871 - 149707
Alignment:
| Q |
197 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149871 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
149772 |
T |
|
| Q |
297 |
tgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttgtg |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149771 |
tgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttgtg |
149707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 6 - 80
Target Start/End: Complemental strand, 150062 - 149988
Alignment:
| Q |
6 |
atttccttcttgacaaggcattggtgaatgatcatgagattgtgatgaagttgtctctgatgaagaagcagctaa |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150062 |
atttccttcttgacaaggcattggtgaatgatcatgagattgtgatgaagttgtctctgatgaagaagcagctaa |
149988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University