View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_11 (Length: 491)
Name: NF11386A_low_11
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 138 - 294
Target Start/End: Original strand, 1109017 - 1109169
Alignment:
| Q |
138 |
ctgtgaacgatggttcagacatatgaatgtgatctttgcagttcacaatgtgtctgaacagattgagatcaataatggcatggaaccccttcctgcagat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1109017 |
ctgtgaacgatggttcagacatatgaatgtgatctttgcagttcacaatgtgtctgaacagattgagatcaataatggcatggaaccccttcctgcagat |
1109116 |
T |
|
| Q |
238 |
gctacagatcatgtgcagagaaatacgtataaggatgtgaagaagaaagcatatatt |
294 |
Q |
| |
|
||||||||| || |||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
1109117 |
gctacagat---gt-cagagaaatatgtataacgatgtgaagaagaaagcatatatt |
1109169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 21 - 129
Target Start/End: Complemental strand, 35006297 - 35006189
Alignment:
| Q |
21 |
atcaaactgcagaagagtggaggctataccttatgactattatcaagggattcagtgacatcaaaagagctgtaaactagaggaatttctttaaagcact |
120 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35006297 |
atcaaactgcggaagagtggaggctataccttatgactattatcaagggattcagtgacatcaaaagagctgtaaactagaggaatttctttaaagcact |
35006198 |
T |
|
| Q |
121 |
cagtgaacg |
129 |
Q |
| |
|
||||||||| |
|
|
| T |
35006197 |
cagtgaacg |
35006189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University