View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_121 (Length: 344)
Name: NF11386A_low_121
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_121 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 325
Target Start/End: Original strand, 1329762 - 1330086
Alignment:
| Q |
1 |
agtgacaactgaagaacatggggacaaacttgccttagttttatttgatggggctgcaccagcaacaagtgaaggtggaataaaagcacttccatggcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329762 |
agtgacaactgaagaacatggggacaaactagccttagctttatttgatggggctgcaccagcaacaagtgaaggtggaataaaagcacttccatggcat |
1329861 |
T |
 |
| Q |
101 |
gcatttgacgagagtgcagattgggaaacagcgttggtacaatcaaccagccacttaggaaaccagcagcctgcattaggtggaggctttgatacattat |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329862 |
gcatttgatgagagtgcagattgggaaacagcgttggtacaatcaaccagccacttaggaaaccagcagcctgcattaggtggaggctttgatacattat |
1329961 |
T |
 |
| Q |
201 |
tgttggatggtatgtataaacaaggagaaatgaatgcagccatgcaaggagtgggatatggttgcagtggaagtgctagcagtgtagcacttggttcagc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329962 |
tgttggatggtatgtataaacaaggagaaatgaatgcagccatgcaaggagtgggatatggtggcagtggaagtgctagcagtgtagcacttggttcagc |
1330061 |
T |
 |
| Q |
301 |
cggaaggccagcaatgctagcattg |
325 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1330062 |
cggaaggccagcaatgctagcattg |
1330086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University