View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_133 (Length: 337)
Name: NF11386A_low_133
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_133 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 131 - 264
Target Start/End: Complemental strand, 47117572 - 47117439
Alignment:
| Q |
131 |
aaaatttcatactaattttcaaaataatgtgattagtagtaaattcaactcgcatgaagcttaccataggtgaacgaggtctcattggtggaggttgttc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47117572 |
aaaatttcatactaattttcaaaataatgtgattagtagtaaattcaactcgcatgaagcttaccataggtgaacgaggtctcattggtggaggttgttc |
47117473 |
T |
|
| Q |
231 |
ttgagtactcttaactgtctaatagaatgcaaca |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47117472 |
ttgagtactcttaactgtctaatagaatgcaaca |
47117439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University