View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_136 (Length: 335)
Name: NF11386A_low_136
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_136 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 7e-43; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 6330553 - 6330398
Alignment:
| Q |
1 |
aacataaggccattggatttaccaacttaaccgctagaacaagctaggcaactatctattgttgcgcgcaacacatgtatatatgatataatttcttata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| || |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
6330553 |
aacataaggccattggatttaccaacttaaccgctagaacaagctaggcaattatccattctt--gcgcaacaca--tatatataatataatttcttata |
6330458 |
T |
|
| Q |
101 |
aaatctttgtaatcatacctattaaaaattaannnnnnnagggttgggatgagtcatgac |
160 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
6330457 |
aaatctttctaaccatacctattaaaaattaatttttttagggttggggtgagtcatgac |
6330398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 232 - 331
Target Start/End: Complemental strand, 6330274 - 6330173
Alignment:
| Q |
232 |
aacttgcaccgtagagaatcaaacctaagaccaactcaagtgggttgaaaaggctcattttctagtttaaaaaataatg--atgcatttagatttgttat |
329 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
6330274 |
aacttgcaccgtagagaatcgaacctaagaccaactcaagtgggttgaaaaggctcattttctagtttagaaaataatgatatacatttagatttgttat |
6330175 |
T |
|
| Q |
330 |
tg |
331 |
Q |
| |
|
|| |
|
|
| T |
6330174 |
tg |
6330173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 232
Target Start/End: Complemental strand, 6330387 - 6330345
Alignment:
| Q |
190 |
tgtgtgtttcgtgtctgtatctatgcttcataagttactagta |
232 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
6330387 |
tgtgtgtttcgtgtctgtatctatacttcataggttactagta |
6330345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University