View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_154 (Length: 321)
Name: NF11386A_low_154
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_154 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 2 - 308
Target Start/End: Original strand, 38720695 - 38721001
Alignment:
| Q |
2 |
tgcaacttcaatagcaagttctaatcagtggactcaagtttatcataaagcaattctggatataattagatccggaacaggtgttaaatcaagtaatgca |
101 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38720695 |
tgcaacttcaatatcaagttctaatcagtggactcaagtttatcagaaagcaattctggatataattagatccggaacaggtgttaaatcaagtaatgca |
38720794 |
T |
|
| Q |
102 |
tctagattttccgctttgttatttgtcactcgcgcgaatgacatagaggctttgaaaaagctcattgaataccggaatataaatctagatgaacaaaatg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38720795 |
tctagattttccgctttgttatttgtcactcgcgcgaatgacatagaggctttgaaaaagctcatagaataccggaatataaatctagatgaacaaaatg |
38720894 |
T |
|
| Q |
202 |
gaaatggactttcagctgtcatgatagctgccgcagagggtaacgtggaagctttcaaggtacttcttcatgctggagctgatgtaatcaatcttaaaaa |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38720895 |
gaaatggactttcagctgtcatgatagctgccgcagagggtaacgtggaagctttcaaggtacttcttcatgctggagctgatgtaatcaatcttaaaaa |
38720994 |
T |
|
| Q |
302 |
cagatat |
308 |
Q |
| |
|
||||||| |
|
|
| T |
38720995 |
cagatat |
38721001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University