View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_156 (Length: 317)
Name: NF11386A_low_156
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_156 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 21 - 317
Target Start/End: Complemental strand, 25641919 - 25641623
Alignment:
| Q |
21 |
agcatctacactagattcctagccactagactaaatcccaacaatagagatgattagttagacataatataagttacgtgttttgggagccttctttttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25641919 |
agcatctacactagattcctagccactagactaaatcccaacaatagagatgattagttagacataatataagttacgtgttttgggagccttctttttt |
25641820 |
T |
|
| Q |
121 |
atgatggctgcaggttgttgtttcaagttcgggtacgggtggtgttttatggtgaaggcactatgcttctgtcttggtgtggagtgccttgttatttctt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25641819 |
atgatggctgcaggttgttgtttcaagttcgggtacgggtggtgttttatggtgaaggcactatgcttctgtcttggtgtggagtcccttgttatttctt |
25641720 |
T |
|
| Q |
221 |
caagtacctgttagttttcggttttggcactaaaggcggattattatgctttttgttcttctggtatagtgtatgggtgtaggaagtgtttgtagct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25641719 |
caagtacctgttagttttcggttttggcactaaaggcggattattatgctttttgttcttctggtatagtgtatgggtgtaggaagtgtttgtagct |
25641623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University