View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_157 (Length: 317)
Name: NF11386A_low_157
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_157 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 39 - 306
Target Start/End: Original strand, 43239075 - 43239342
Alignment:
| Q |
39 |
catgtaaactattgtcttatacatgattcatacatttttctatgctgttttgttagtaattgttaacatcattaatgagtgtttcattcaatttgcagat |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43239075 |
catgtaaactattgtcttatacatgattcatacatttttctatgctgttttgttagtaattgttaacatcattaatgggtgtttcattcaatttgcagat |
43239174 |
T |
 |
| Q |
139 |
tcatggcaacaagtggggttgatgttggtgacaggcttcaactgtggttggatattcagtttctctaacctgataatggttccattaggttggacatggg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43239175 |
tcatggcaacaagtggggttgatgttggtgacaggcttcaactgtggttggatattcagtttctctaacctgataatggttccattaggttggacatggg |
43239274 |
T |
 |
| Q |
239 |
gtatcatattgctctttgttattggactctacacagcttatgctaattggctcttggcagcttttcat |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43239275 |
gtatcatattgctctttgttattggactctacacagcttatgctaattggctcttggcagcttttcat |
43239342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University