View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11386A_low_177 (Length: 306)
Name: NF11386A_low_177
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11386A_low_177 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 18 - 297
Target Start/End: Complemental strand, 164331 - 164052
Alignment:
| Q |
18 |
atcactagttataagctttctattatggtttataattagaattctttaactgttatcatggagattcgttatgttcctacttgtatgtatttgttcctaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
164331 |
atcactagttataagctttctattatggtttataattagaattctttaactgttatcatggagattcgttatgttcctacttgtatgtatttgttcctaa |
164232 |
T |
|
| Q |
118 |
cattgcagtaactgacagtgctatttatataaagcgttctttcattctaatgcaactcaatagttcatttctaaccctttttatggtatcatgagctttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
164231 |
cattgcagtaactgacagtgctatttatataaagcgttctttcattctaatgcaactcaatagttcatttctaaccctttttatggtatcatgagctttt |
164132 |
T |
|
| Q |
218 |
gcataacaacgaacttgaaccatattttttgaacactctcagccatgtctgttgaatctctatccactactgatattctt |
297 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
164131 |
gcataacaacgaacttgatccatattttttgaacactctcagccatgtctgttgaatctctatccactactgatattctt |
164052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University